ID: 1075536952_1075536960

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1075536952 1075536960
Species Human (GRCh38) Human (GRCh38)
Location 10:123279247-123279269 10:123279288-123279310
Sequence CCACTCACCGAGGCCTTCTCTGA GTGAACTGTGGAAGGTAATGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 52, 4: 314} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!