ID: 1075579877_1075579883

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1075579877 1075579883
Species Human (GRCh38) Human (GRCh38)
Location 10:123609393-123609415 10:123609418-123609440
Sequence CCAGCCCCTAGCAGCTGCTACTG TCTCTTCGACTGGGCACTACTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!