ID: 1075579880_1075579885

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1075579880 1075579885
Species Human (GRCh38) Human (GRCh38)
Location 10:123609399-123609421 10:123609422-123609444
Sequence CCTAGCAGCTGCTACTGCTTCTC TTCGACTGGGCACTACTGGAGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 38, 4: 329} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!