|
Left Crispr |
Right Crispr |
| Crispr ID |
1075600190 |
1075600197 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
10:123761910-123761932
|
10:123761932-123761954
|
| Sequence |
CCCTCCTCCTTCTGGAAGTCCTC |
CCGTGTGGCACACCCTCCTCCGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 1, 2: 9, 3: 89, 4: 621} |
{0: 1, 1: 2, 2: 1, 3: 6, 4: 95} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|