ID: 1075635053_1075635057

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1075635053 1075635057
Species Human (GRCh38) Human (GRCh38)
Location 10:124024960-124024982 10:124024982-124025004
Sequence CCAGTTTTTACCAAAGATGCCCA ACAGAACTACCCAAATTGTTTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 10, 4: 128}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!