ID: 1075645187_1075645191

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1075645187 1075645191
Species Human (GRCh38) Human (GRCh38)
Location 10:124092398-124092420 10:124092416-124092438
Sequence CCGGCAACTCCCGAGTCACGCCG CGCCGCCTCCCGAGACGCGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 25} {0: 1, 1: 0, 2: 0, 3: 8, 4: 136}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!