ID: 1075685861_1075685877

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1075685861 1075685877
Species Human (GRCh38) Human (GRCh38)
Location 10:124364735-124364757 10:124364787-124364809
Sequence CCATAGAAGAAGCAAGGGATGGT GGGGAGGGAGGGCCTGAGAAAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!