ID: 1075697088_1075697093

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1075697088 1075697093
Species Human (GRCh38) Human (GRCh38)
Location 10:124444505-124444527 10:124444532-124444554
Sequence CCAAACATAGCAGCATGTGCCTG CCCAGCTACTCAGAAGGCTGAGG
Strand - +
Off-target summary No data {0: 3774, 1: 101495, 2: 206159, 3: 237850, 4: 152587}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!