ID: 1075734354_1075734358

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1075734354 1075734358
Species Human (GRCh38) Human (GRCh38)
Location 10:124654834-124654856 10:124654852-124654874
Sequence CCGGCGTGCCTCTGCTCGCCCTG CCCTGTCTGTGTCTGGTCTAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 9, 4: 166}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!