ID: 1075742999_1075743012

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1075742999 1075743012
Species Human (GRCh38) Human (GRCh38)
Location 10:124707057-124707079 10:124707085-124707107
Sequence CCCCGCCCACCCCTGCCATGCCA GGGCTGCCTCACTTGTAAAATGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 6, 3: 79, 4: 802} {0: 1, 1: 0, 2: 0, 3: 54, 4: 416}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!