ID: 1075744561_1075744567

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1075744561 1075744567
Species Human (GRCh38) Human (GRCh38)
Location 10:124717705-124717727 10:124717756-124717778
Sequence CCAAGCTCAATCCTTATGCATAC CTAACAACAACCTGATTTAGAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!