ID: 1075778620_1075778631

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1075778620 1075778631
Species Human (GRCh38) Human (GRCh38)
Location 10:125003297-125003319 10:125003325-125003347
Sequence CCAAGGTCAGTGCAGGCCCCGGC AGGGTGGGCCCACCTTCTCGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 223} {0: 1, 1: 0, 2: 0, 3: 8, 4: 90}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!