ID: 1075807337_1075807338

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1075807337 1075807338
Species Human (GRCh38) Human (GRCh38)
Location 10:125199358-125199380 10:125199383-125199405
Sequence CCTTCTCATAATTGAAGAGAACA GAGAGAGTCAAGAATATTTCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 29, 4: 224}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!