ID: 1075844047_1075844051

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1075844047 1075844051
Species Human (GRCh38) Human (GRCh38)
Location 10:125530682-125530704 10:125530714-125530736
Sequence CCTGTCAGCAGCAGGGCAGAGTT GGAAGTCCAGCCCTAGATCTAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!