ID: 1075897132_1075897134

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1075897132 1075897134
Species Human (GRCh38) Human (GRCh38)
Location 10:126006442-126006464 10:126006464-126006486
Sequence CCACGTGCCATGTGTGGTAGTGA ACAGCCACACACTCCTTGATTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 14, 4: 139}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!