ID: 1075953742_1075953753

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1075953742 1075953753
Species Human (GRCh38) Human (GRCh38)
Location 10:126504757-126504779 10:126504793-126504815
Sequence CCCACGCGTCTGGCCGTGATGGT CCTCTGCGGGGGCCCCCACAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 91} {0: 1, 1: 0, 2: 1, 3: 9, 4: 170}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!