ID: 1076021557_1076021568

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1076021557 1076021568
Species Human (GRCh38) Human (GRCh38)
Location 10:127077848-127077870 10:127077888-127077910
Sequence CCCTGAGCTTTGAGGGGTGGGTG GCATTCCATGGAGGGGCAGGAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 30, 4: 269}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!