ID: 1076021557_1076021573

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1076021557 1076021573
Species Human (GRCh38) Human (GRCh38)
Location 10:127077848-127077870 10:127077899-127077921
Sequence CCCTGAGCTTTGAGGGGTGGGTG AGGGGCAGGAGGGTATGGATGGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 2, 3: 81, 4: 1126}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!