ID: 1076058225_1076058234

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1076058225 1076058234
Species Human (GRCh38) Human (GRCh38)
Location 10:127392711-127392733 10:127392743-127392765
Sequence CCTGGGAGAGCGAAAGGCCATGC CCCCACCCCCAGCGCCGGGTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 136} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!