ID: 1076058226_1076058238

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1076058226 1076058238
Species Human (GRCh38) Human (GRCh38)
Location 10:127392728-127392750 10:127392745-127392767
Sequence CCATGCCTCCCACCTCCCCACCC CCACCCCCAGCGCCGGGTCGGGG
Strand - +
Off-target summary {0: 1, 1: 12, 2: 60, 3: 447, 4: 3699} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!