ID: 1076097401_1076097406

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1076097401 1076097406
Species Human (GRCh38) Human (GRCh38)
Location 10:127742999-127743021 10:127743034-127743056
Sequence CCTAAAGGCATAGTATTTTCAAA TTCAGGATTTGACTCCAGGTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 36, 4: 388} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!