ID: 1076136621_1076136626

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1076136621 1076136626
Species Human (GRCh38) Human (GRCh38)
Location 10:128049572-128049594 10:128049588-128049610
Sequence CCAAGAAGTATTTTCCCATCCCC CATCCCCGTGGAGCACCTGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 227} {0: 1, 1: 0, 2: 0, 3: 17, 4: 132}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!