ID: 1076219607_1076219610

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1076219607 1076219610
Species Human (GRCh38) Human (GRCh38)
Location 10:128722660-128722682 10:128722677-128722699
Sequence CCTTCGGATGGCTGCTCGAGGGG GAGGGGAAACTGAGTCAGGCTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!