ID: 1076307191_1076307205

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1076307191 1076307205
Species Human (GRCh38) Human (GRCh38)
Location 10:129473847-129473869 10:129473881-129473903
Sequence CCCCGCACCCCACTAGAGAGTGG CAGTGGGGCCAGAGGAAAGATGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 5, 3: 58, 4: 560}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!