ID: 1076330321_1076330323

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1076330321 1076330323
Species Human (GRCh38) Human (GRCh38)
Location 10:129659559-129659581 10:129659586-129659608
Sequence CCGAGGCTACTGGCATTATTATT GATGAGTTAGTGCAAATTGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 202} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!