ID: 1076354017_1076354019

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1076354017 1076354019
Species Human (GRCh38) Human (GRCh38)
Location 10:129839459-129839481 10:129839475-129839497
Sequence CCAGGCGCTGGGCAGGCACAGGG CACAGGGTGCCCACCCCGTGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 13, 4: 115}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!