ID: 1076354023_1076354028

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1076354023 1076354028
Species Human (GRCh38) Human (GRCh38)
Location 10:129839488-129839510 10:129839504-129839526
Sequence CCCCGTGTGGCCTCATCTGTGGA CTGTGGACAGCTGTGCCCTCGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!