ID: 1076379551_1076379562

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1076379551 1076379562
Species Human (GRCh38) Human (GRCh38)
Location 10:130015751-130015773 10:130015770-130015792
Sequence CCAAGCTCAGGGCCCTATCCCAG CCAGTGGGCCTGGGGCCAGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 262} {0: 1, 1: 0, 2: 3, 3: 77, 4: 556}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!