ID: 1076379561_1076379576

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1076379561 1076379576
Species Human (GRCh38) Human (GRCh38)
Location 10:130015770-130015792 10:130015799-130015821
Sequence CCAGTGGGCCTGGGGCCAGGCGG TGGGGATTGGGGAGCAGGGGTGG
Strand - +
Off-target summary No data {0: 1, 1: 2, 2: 19, 3: 198, 4: 1755}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!