ID: 1076379561_1076379578

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1076379561 1076379578
Species Human (GRCh38) Human (GRCh38)
Location 10:130015770-130015792 10:130015801-130015823
Sequence CCAGTGGGCCTGGGGCCAGGCGG GGGATTGGGGAGCAGGGGTGGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 18, 3: 164, 4: 1335}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!