ID: 1076386872_1076386877

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1076386872 1076386877
Species Human (GRCh38) Human (GRCh38)
Location 10:130063410-130063432 10:130063456-130063478
Sequence CCCGGCTTTGGTTGTTTGGCACG ATAGCTCTGGGATCTTACCCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 11, 4: 138}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!