ID: 1076403516_1076403525

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1076403516 1076403525
Species Human (GRCh38) Human (GRCh38)
Location 10:130197858-130197880 10:130197878-130197900
Sequence CCTGGTGGAGGAGCATCACCTGG TGGGGGGAGCATCACTTGTGGGG
Strand - +
Off-target summary {0: 2, 1: 2, 2: 5, 3: 49, 4: 337} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!