ID: 1076438472_1076438476

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1076438472 1076438476
Species Human (GRCh38) Human (GRCh38)
Location 10:130462859-130462881 10:130462875-130462897
Sequence CCATGAGGGGTGATGGAGATGCA AGATGCACACTGCAGTGGTGGGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 3, 3: 15, 4: 203}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!