ID: 1076480736_1076480748

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1076480736 1076480748
Species Human (GRCh38) Human (GRCh38)
Location 10:130783709-130783731 10:130783745-130783767
Sequence CCGAGGGAGGGTCTGCTGGGGTG CTGTGTGAGGGGGTGCTGGTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 44, 4: 485}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!