ID: 1076516084_1076516096

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1076516084 1076516096
Species Human (GRCh38) Human (GRCh38)
Location 10:131045158-131045180 10:131045205-131045227
Sequence CCAGGAAAGGCCTTTACTGCAAC ATGATATGCCCCTCTCCTGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 121} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!