ID: 1076554291_1076554301

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1076554291 1076554301
Species Human (GRCh38) Human (GRCh38)
Location 10:131311818-131311840 10:131311835-131311857
Sequence CCCGCCCCGGTCCCCGCCCGCCC CCGCCCGCGCCCCTCCCCGCCGG
Strand - +
Off-target summary {0: 1, 1: 4, 2: 28, 3: 289, 4: 2111} {0: 1, 1: 1, 2: 5, 3: 84, 4: 617}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!