ID: 1076568591_1076568597 |
View in Genome Browser |
Spacer: 19 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1076568591 | 1076568597 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 10:131415921-131415943 | 10:131415963-131415985 |
| Sequence | CCCTTCTCCTTCTCCTTCTCCTT | TTCCTCCCCTTCTCCTTCATAGG |
| Strand | - | + |
| Off-target summary | {0: 25, 1: 106, 2: 378, 3: 1647, 4: 6294} | No data |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||