ID: 1076568591_1076568597

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1076568591 1076568597
Species Human (GRCh38) Human (GRCh38)
Location 10:131415921-131415943 10:131415963-131415985
Sequence CCCTTCTCCTTCTCCTTCTCCTT TTCCTCCCCTTCTCCTTCATAGG
Strand - +
Off-target summary {0: 25, 1: 106, 2: 378, 3: 1647, 4: 6294} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!