ID: 1076571523_1076571525

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1076571523 1076571525
Species Human (GRCh38) Human (GRCh38)
Location 10:131436261-131436283 10:131436311-131436333
Sequence CCAGCAGGACACCTTCGGGGCTG AACAAAAATGTTATTAGTTTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 97} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!