ID: 1076620065_1076620071

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1076620065 1076620071
Species Human (GRCh38) Human (GRCh38)
Location 10:131781311-131781333 10:131781341-131781363
Sequence CCAGCTGTCCTGCTCAGGGGCCT CAGGCACAACAGAGGGATGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 29, 4: 340} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!