ID: 1076623064_1076623068

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1076623064 1076623068
Species Human (GRCh38) Human (GRCh38)
Location 10:131805189-131805211 10:131805209-131805231
Sequence CCACGCCACTTTGGACTTCTTTG TTGTTATTATTAAGGATAAAGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!