ID: 1076634576_1076634578

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1076634576 1076634578
Species Human (GRCh38) Human (GRCh38)
Location 10:131873975-131873997 10:131874000-131874022
Sequence CCAGAAGGAAAATGCCTCAGTGT CTTTCCTCTGTGCTAGAAAATGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!