ID: 1076666263_1076666271 |
View in Genome Browser |
Spacer: 19 |
Left Crispr | Right Crispr | |
---|---|---|
Crispr ID | 1076666263 | 1076666271 |
Species | Human (GRCh38) | Human (GRCh38) |
Location | 10:132094701-132094723 | 10:132094743-132094765 |
Sequence | CCGGTTGGCCTCCTGCTGGGAGG | TCTGCTGTGGGAGCATAGAGAGG |
Strand | - | + |
Off-target summary | {0: 1, 1: 4, 2: 7, 3: 39, 4: 242} | No data |
Status | Not started |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer | Left Crispr | Right Crispr | ||||||
---|---|---|---|---|---|---|---|---|
Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
No off target data available for this pair! |