ID: 1076666263_1076666271

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1076666263 1076666271
Species Human (GRCh38) Human (GRCh38)
Location 10:132094701-132094723 10:132094743-132094765
Sequence CCGGTTGGCCTCCTGCTGGGAGG TCTGCTGTGGGAGCATAGAGAGG
Strand - +
Off-target summary {0: 1, 1: 4, 2: 7, 3: 39, 4: 242} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!