ID: 1076673164_1076673174

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1076673164 1076673174
Species Human (GRCh38) Human (GRCh38)
Location 10:132134102-132134124 10:132134140-132134162
Sequence CCGCTTCCTTGCTGCCGCTCCGC CGTGGTTCTGGGATGCGCTGGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!