ID: 1076673381_1076673384

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1076673381 1076673384
Species Human (GRCh38) Human (GRCh38)
Location 10:132135348-132135370 10:132135368-132135390
Sequence CCCCTCAAGGGCTGGTTGACTAA TAACCCCTGCTCTGCGTTAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 70} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!