ID: 1076673382_1076673385

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1076673382 1076673385
Species Human (GRCh38) Human (GRCh38)
Location 10:132135349-132135371 10:132135369-132135391
Sequence CCCTCAAGGGCTGGTTGACTAAC AACCCCTGCTCTGCGTTAGTGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 4, 4: 51} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!