ID: 1076674660_1076674669

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1076674660 1076674669
Species Human (GRCh38) Human (GRCh38)
Location 10:132141781-132141803 10:132141806-132141828
Sequence CCCTCATGCTGCTAGAGAGACCC CCATACACCATTTGATATCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 141} {0: 1, 1: 0, 2: 9, 3: 185, 4: 2311}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!