ID: 1076674763_1076674770

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1076674763 1076674770
Species Human (GRCh38) Human (GRCh38)
Location 10:132142192-132142214 10:132142208-132142230
Sequence CCATGGAAGCCGATCAAAACCAG AAACCAGGGATTGGGGATCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 98} {0: 1, 1: 0, 2: 2, 3: 12, 4: 201}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!