ID: 1076680792_1076680806

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1076680792 1076680806
Species Human (GRCh38) Human (GRCh38)
Location 10:132170247-132170269 10:132170280-132170302
Sequence CCAGAGGTCGGGAGCTCCACAGC CCCCGAGGGCGGCTGGGGACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 24, 3: 849, 4: 15117} {0: 1, 1: 1, 2: 2, 3: 23, 4: 273}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!