ID: 1076701430_1076701441

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1076701430 1076701441
Species Human (GRCh38) Human (GRCh38)
Location 10:132275237-132275259 10:132275264-132275286
Sequence CCAGGCCCCATGGCTACTCACAG CCCCACAGGGCCGCTGGTGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 220} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!