ID: 1076701432_1076701436

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1076701432 1076701436
Species Human (GRCh38) Human (GRCh38)
Location 10:132275243-132275265 10:132275258-132275280
Sequence CCCATGGCTACTCACAGACAGCC AGACAGCCCCACAGGGCCGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 126} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!